|
Left Crispr |
Right Crispr |
| Crispr ID |
1087673143 |
1087673159 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:101129085-101129107
|
11:101129112-101129134
|
| Sequence |
CCTTTTCTCCTCCCCCGTCTCCA |
GAGGGAAAAGGGAAGGAGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 7, 3: 127, 4: 1178} |
{0: 2, 1: 6, 2: 131, 3: 1064, 4: 5826} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|