ID: 1087683304_1087683308

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1087683304 1087683308
Species Human (GRCh38) Human (GRCh38)
Location 11:101238123-101238145 11:101238136-101238158
Sequence CCAGTTCTCATGATCTGAGTCAA TCTGAGTCAAGGTCCCAGTGGGG
Strand - +
Off-target summary No data {0: 68, 1: 74, 2: 71, 3: 57, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!