ID: 1087708337_1087708339

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1087708337 1087708339
Species Human (GRCh38) Human (GRCh38)
Location 11:101520903-101520925 11:101520940-101520962
Sequence CCTGGCAGCTTCTAACAGCATTT GCAAAGGAATGATCTGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 33, 3: 104, 4: 477} {0: 1, 1: 7, 2: 64, 3: 157, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!