ID: 1087729047_1087729050

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1087729047 1087729050
Species Human (GRCh38) Human (GRCh38)
Location 11:101757934-101757956 11:101757969-101757991
Sequence CCATCATGCTTCTACATACATGG ATGGCCAAGAAGCTCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 115} {0: 1, 1: 2, 2: 3, 3: 25, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!