ID: 1087741439_1087741443

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1087741439 1087741443
Species Human (GRCh38) Human (GRCh38)
Location 11:101892089-101892111 11:101892123-101892145
Sequence CCAAATGCCCTCAAGAAAAATTC TGAGGTGTACCTTTTCTTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 307} {0: 1, 1: 0, 2: 2, 3: 16, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!