ID: 1087761732_1087761745

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1087761732 1087761745
Species Human (GRCh38) Human (GRCh38)
Location 11:102110328-102110350 11:102110376-102110398
Sequence CCGGGCCGCGGTGCGGGCGGGCG AGGCGGGGCCGCGGCGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 51, 4: 326} {0: 1, 1: 1, 2: 17, 3: 175, 4: 1065}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!