|
Left Crispr |
Right Crispr |
| Crispr ID |
1087766800 |
1087766801 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:102164129-102164151
|
11:102164147-102164169
|
| Sequence |
CCAGGTTCAAGTGATTCTCGCGC |
CGCGCCTCAGCCTCCCGAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 1858, 2: 44109, 3: 95846, 4: 115373} |
{0: 1, 1: 0, 2: 151, 3: 1729, 4: 4935} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|