ID: 1087768324_1087768331

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1087768324 1087768331
Species Human (GRCh38) Human (GRCh38)
Location 11:102180247-102180269 11:102180284-102180306
Sequence CCTCATGATCCTCCCTCCTTGGC CTAATTAGTAGATCCTATACTGG
Strand - +
Off-target summary {0: 6, 1: 279, 2: 4765, 3: 25221, 4: 60224} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!