ID: 1087809067_1087809069

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1087809067 1087809069
Species Human (GRCh38) Human (GRCh38)
Location 11:102590597-102590619 11:102590623-102590645
Sequence CCTTGGCACATTACTTACGTCAC CTGAACTAGCATGAGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58} {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!