ID: 1087822663_1087822668

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1087822663 1087822668
Species Human (GRCh38) Human (GRCh38)
Location 11:102729651-102729673 11:102729685-102729707
Sequence CCAGCCTGACCAACATGGAGGAA CTGAAAATACAAAATAAGCTGGG
Strand - +
Off-target summary {0: 131, 1: 18991, 2: 37342, 3: 136677, 4: 175403} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!