ID: 1087853442_1087853447

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1087853442 1087853447
Species Human (GRCh38) Human (GRCh38)
Location 11:103060499-103060521 11:103060536-103060558
Sequence CCACAGGGATGACTGTAGGACTT TTGGGTATACACAAGGGTCCTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 9, 3: 53, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!