ID: 1087879954_1087879957

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1087879954 1087879957
Species Human (GRCh38) Human (GRCh38)
Location 11:103404481-103404503 11:103404518-103404540
Sequence CCTACTGATGAGATAATATTTCA CAGGATAATCAGAGTAATGTTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 7, 3: 30, 4: 232} {0: 1, 1: 0, 2: 2, 3: 13, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!