ID: 1087880729_1087880735

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1087880729 1087880735
Species Human (GRCh38) Human (GRCh38)
Location 11:103413011-103413033 11:103413061-103413083
Sequence CCTACCCTCCAGACTACTGAATC TTTGTTTTATCAAGCTCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157} {0: 1, 1: 0, 2: 2, 3: 40, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!