ID: 1087913957_1087913961

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1087913957 1087913961
Species Human (GRCh38) Human (GRCh38)
Location 11:103786424-103786446 11:103786474-103786496
Sequence CCAGTTGGTGGAACAGTCAGCAC TCTTACATGGGCATGGTTTATGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 81, 3: 166, 4: 375} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!