ID: 1087946422_1087946431

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1087946422 1087946431
Species Human (GRCh38) Human (GRCh38)
Location 11:104165057-104165079 11:104165099-104165121
Sequence CCAGCCCTTCCACAGGAAAGGGC GAGCAGGAACAGACTGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!