ID: 1088011157_1088011165

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1088011157 1088011165
Species Human (GRCh38) Human (GRCh38)
Location 11:105002420-105002442 11:105002452-105002474
Sequence CCCCCTTCCTTCTCCTTTTTCTT CTCAAACATTTCTTATATTTAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 80, 3: 714, 4: 4572} {0: 1, 1: 1, 2: 5, 3: 56, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!