|
Left Crispr |
Right Crispr |
Crispr ID |
1088011157 |
1088011165 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:105002420-105002442
|
11:105002452-105002474
|
Sequence |
CCCCCTTCCTTCTCCTTTTTCTT |
CTCAAACATTTCTTATATTTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 4, 2: 80, 3: 714, 4: 4572} |
{0: 1, 1: 1, 2: 5, 3: 56, 4: 490} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|