ID: 1088080531_1088080537

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1088080531 1088080537
Species Human (GRCh38) Human (GRCh38)
Location 11:105906601-105906623 11:105906642-105906664
Sequence CCATCTCTAGATTTCCATCTTCT GCAGGCTGCCAGCTAATACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 434} {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!