|
Left Crispr |
Right Crispr |
Crispr ID |
1088154798 |
1088154810 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:106790258-106790280
|
11:106790303-106790325
|
Sequence |
CCCTGTGGCCACCACCACCATAG |
CTACCGCTGATGTTCACTTAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 10, 2: 64, 3: 230, 4: 642} |
{0: 1, 1: 13, 2: 133, 3: 300, 4: 666} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|