ID: 1088156259_1088156260

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1088156259 1088156260
Species Human (GRCh38) Human (GRCh38)
Location 11:106807572-106807594 11:106807606-106807628
Sequence CCTAGATACATGTACTTACTAGC ATATTGAGTGTAAACGTCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80} {0: 1, 1: 1, 2: 19, 3: 568, 4: 1786}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!