ID: 1088162233_1088162239

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1088162233 1088162239
Species Human (GRCh38) Human (GRCh38)
Location 11:106886269-106886291 11:106886310-106886332
Sequence CCTTCCTGTTAATTGGAATGCAT AGCAGACATCCTGGGCAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187} {0: 1, 1: 1, 2: 4, 3: 34, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!