ID: 1088172893_1088172907

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1088172893 1088172907
Species Human (GRCh38) Human (GRCh38)
Location 11:107018044-107018066 11:107018097-107018119
Sequence CCTTCGAGACATGCTGCCGGCGG GACGCGAGCGGCGGCGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22} {0: 1, 1: 0, 2: 4, 3: 68, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!