ID: 1088208910_1088208915

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1088208910 1088208915
Species Human (GRCh38) Human (GRCh38)
Location 11:107430224-107430246 11:107430261-107430283
Sequence CCTTTACAAGGACTAGATCAGGG TGTGAGCCTGTATATGGATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66} {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!