ID: 1088219002_1088219005

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1088219002 1088219005
Species Human (GRCh38) Human (GRCh38)
Location 11:107547440-107547462 11:107547457-107547479
Sequence CCTAGAACAGATACACCTGAAGG TGAAGGAGCCTTTACACGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149} {0: 1, 1: 0, 2: 1, 3: 3, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!