ID: 1088246183_1088246189

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1088246183 1088246189
Species Human (GRCh38) Human (GRCh38)
Location 11:107820357-107820379 11:107820394-107820416
Sequence CCCTGGAAGTCTCAGAATTGCAG CCCACTTTAATCAAGGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204} {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!