ID: 1088294658_1088294667

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1088294658 1088294667
Species Human (GRCh38) Human (GRCh38)
Location 11:108278791-108278813 11:108278811-108278833
Sequence CCCCCATGACTCCGACACCTCCC CCCATTAGGCATAACCTAATGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 115, 3: 1042, 4: 5156} {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!