|
Left Crispr |
Right Crispr |
Crispr ID |
1088308830 |
1088308836 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:108438591-108438613
|
11:108438617-108438639
|
Sequence |
CCATAAAACTCCTAGAAGAAAAT |
GGGGAAAAGCTTCATGACGTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498} |
{0: 2, 1: 25, 2: 188, 3: 658, 4: 1607} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|