ID: 1088324943_1088324953

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1088324943 1088324953
Species Human (GRCh38) Human (GRCh38)
Location 11:108592342-108592364 11:108592367-108592389
Sequence CCAATTTGAAGAGGGTCCCTGGA GTTTCTTTTGTCGGCGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136} {0: 1, 1: 0, 2: 1, 3: 16, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!