ID: 1088368783_1088368791

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1088368783 1088368791
Species Human (GRCh38) Human (GRCh38)
Location 11:109066404-109066426 11:109066449-109066471
Sequence CCTGATCTGGAAGTTCAAAGGCC GTTTGAGGAGAGTTGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!