ID: 1088385077_1088385079

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1088385077 1088385079
Species Human (GRCh38) Human (GRCh38)
Location 11:109245278-109245300 11:109245325-109245347
Sequence CCTACAAAATGAGAGAAAAATTT TCTAATATCCAGAGTCTAGAAGG
Strand - +
Off-target summary {0: 3, 1: 134, 2: 6786, 3: 13924, 4: 11950} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!