ID: 1088439771_1088439775

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1088439771 1088439775
Species Human (GRCh38) Human (GRCh38)
Location 11:109856936-109856958 11:109856965-109856987
Sequence CCAGATTGTTTCATTTCAACTCT TATTGAGCTTTGGATGACACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!