ID: 1088470554_1088470558

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1088470554 1088470558
Species Human (GRCh38) Human (GRCh38)
Location 11:110184421-110184443 11:110184449-110184471
Sequence CCCTGAGGGACTGTGCAGAACAA CCCCAAATGAACAGAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 233} {0: 1, 1: 0, 2: 0, 3: 40, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!