ID: 1088572000_1088572013

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1088572000 1088572013
Species Human (GRCh38) Human (GRCh38)
Location 11:111231408-111231430 11:111231458-111231480
Sequence CCTCACTCCACCTCTAGAAACCT AAAGGATCAGACAGGAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!