ID: 1088604233_1088604250

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1088604233 1088604250
Species Human (GRCh38) Human (GRCh38)
Location 11:111512856-111512878 11:111512909-111512931
Sequence CCCGGTGAAATGGGGTCCGAGGC CGTCCGGGAGCTGCAGCCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!