ID: 1088606007_1088606008

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1088606007 1088606008
Species Human (GRCh38) Human (GRCh38)
Location 11:111532897-111532919 11:111532915-111532937
Sequence CCTTTTTTTCTCAAATACACCAG ACCAGATGTGATTTTCCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 342} {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!