ID: 1088606786_1088606794

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1088606786 1088606794
Species Human (GRCh38) Human (GRCh38)
Location 11:111540710-111540732 11:111540736-111540758
Sequence CCCGCCTCCCGTGCGGTCCGTCG GCCTAGAGATGCTGCTGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36} {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!