ID: 1088616389_1088616391

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1088616389 1088616391
Species Human (GRCh38) Human (GRCh38)
Location 11:111633749-111633771 11:111633765-111633787
Sequence CCTGGGTAACTTGTTCTCCAGGA TCCAGGACTTTTATGGCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146} {0: 1, 1: 0, 2: 15, 3: 110, 4: 1769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!