ID: 1088625493_1088625500

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1088625493 1088625500
Species Human (GRCh38) Human (GRCh38)
Location 11:111727471-111727493 11:111727501-111727523
Sequence CCAACTCTGGTGCTGGAGTAATG CTGCATTTTGATGGGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 115} {0: 1, 1: 0, 2: 2, 3: 16, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!