ID: 1088628738_1088628742

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1088628738 1088628742
Species Human (GRCh38) Human (GRCh38)
Location 11:111753343-111753365 11:111753395-111753417
Sequence CCATTTTCTTTTTGGGGGTTCTA TAAAATCAAATTACTATCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 356} {0: 1, 1: 0, 2: 3, 3: 51, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!