ID: 1088637519_1088637523

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1088637519 1088637523
Species Human (GRCh38) Human (GRCh38)
Location 11:111837503-111837525 11:111837522-111837544
Sequence CCACTCTTTTCCCACACAGACAT ACATTCACAGGTCTGCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 371} {0: 1, 1: 0, 2: 1, 3: 17, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!