ID: 1088648417_1088648424

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1088648417 1088648424
Species Human (GRCh38) Human (GRCh38)
Location 11:111936894-111936916 11:111936947-111936969
Sequence CCACGGGCACACCCGCCTGCAAG AAGCGCATGCATACGCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133} {0: 1, 1: 0, 2: 1, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!