ID: 1088649400_1088649408

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1088649400 1088649408
Species Human (GRCh38) Human (GRCh38)
Location 11:111944132-111944154 11:111944146-111944168
Sequence CCCCACCCTCATCTCCTCATCTT CCTCATCTTCTGCTGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 177, 4: 1096} {0: 1, 1: 0, 2: 8, 3: 34, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!