ID: 1088653276_1088653288

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1088653276 1088653288
Species Human (GRCh38) Human (GRCh38)
Location 11:111976953-111976975 11:111976980-111977002
Sequence CCTGACCTGTCCGACCGACCCCT CACCAAGGGAGGGCTCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59} {0: 1, 1: 0, 2: 4, 3: 27, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!