ID: 1088669975_1088669983

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1088669975 1088669983
Species Human (GRCh38) Human (GRCh38)
Location 11:112131421-112131443 11:112131434-112131456
Sequence CCCCAGATCTTCCCCTGGAACAG CCTGGAACAGACATCAGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 184} {0: 1, 1: 1, 2: 0, 3: 18, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!