ID: 1088680115_1088680116

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1088680115 1088680116
Species Human (GRCh38) Human (GRCh38)
Location 11:112233145-112233167 11:112233177-112233199
Sequence CCTTGGTTTTGTCTCTAGGAGGC GCCCCTTGATCATAAGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 136} {0: 1, 1: 0, 2: 2, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!