ID: 1088693101_1088693108

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1088693101 1088693108
Species Human (GRCh38) Human (GRCh38)
Location 11:112344554-112344576 11:112344590-112344612
Sequence CCTCAGAGCTATACTGGAAGGGA TGATCCCCCTGTGGCAGAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 66, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!