ID: 1088707320_1088707327

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1088707320 1088707327
Species Human (GRCh38) Human (GRCh38)
Location 11:112475575-112475597 11:112475614-112475636
Sequence CCCAGGGCCTTCCTAGCACTGAT ATTCTAGGTATAGACTTCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!