ID: 1088733300_1088733309

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1088733300 1088733309
Species Human (GRCh38) Human (GRCh38)
Location 11:112703263-112703285 11:112703294-112703316
Sequence CCACTTGTGGAGGGAAGGGCCTG ATGTGTTGAGGGAGGCAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 115, 4: 894} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!