ID: 1088743159_1088743164

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1088743159 1088743164
Species Human (GRCh38) Human (GRCh38)
Location 11:112783446-112783468 11:112783487-112783509
Sequence CCTCCAGGTGCAAGAAGGTCCTA CTGTGTTACAGTGAGTTGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!