ID: 1088767634_1088767636

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1088767634 1088767636
Species Human (GRCh38) Human (GRCh38)
Location 11:112999237-112999259 11:112999263-112999285
Sequence CCTTCACTCCTCTAAGTGGAAAA ATTGCTAAAAATAAAACTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 215} {0: 1, 1: 0, 2: 6, 3: 76, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!