ID: 1088789479_1088789487

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1088789479 1088789487
Species Human (GRCh38) Human (GRCh38)
Location 11:113211737-113211759 11:113211762-113211784
Sequence CCATAGCATAGTGTCCAACCTCT GTTCAGGGATGCAGGGGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93} {0: 1, 1: 0, 2: 3, 3: 39, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!